|
OriGene
human tmem30a cdna ![]() Human Tmem30a Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc03073457-100-0-6?v=OriGene Average 90 stars, based on 1 article reviews
human tmem30a cdna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Selleck Chemicals
p38 mapk antagonist sb203580 ![]() P38 Mapk Antagonist Sb203580, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc04538235-59-1-8?v=Selleck+Chemicals Average 96 stars, based on 1 article reviews
p38 mapk antagonist sb203580 - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp fgf8a dr03105657 m1 ![]() Gene Exp Fgf8a Dr03105657 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/bio_rxiv__419705-173-20-21?v=Thermo+Fisher Average 86 stars, based on 1 article reviews
gene exp fgf8a dr03105657 m1 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
quant it highsensitivity dna assay kit ![]() Quant It Highsensitivity Dna Assay Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pm35896060-112-8-13?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
quant it highsensitivity dna assay kit - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Toyobo
thunderbird probe one step qrt pcr kit ![]() Thunderbird Probe One Step Qrt Pcr Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/med_rxiv__2020__08__06__20168294-37-41-46?v=Toyobo Average 96 stars, based on 1 article reviews
thunderbird probe one step qrt pcr kit - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
OriGene
anti ung2 ![]() Anti Ung2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc04828845-295-15-18?v=OriGene Average 90 stars, based on 1 article reviews
anti ung2 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
ATCC
herpes simplex virus type 2 vr 540dq ![]() Herpes Simplex Virus Type 2 Vr 540dq, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc11788701__alm___45___2___218___supple-8-45-68?v=ATCC Average 99 stars, based on 1 article reviews
herpes simplex virus type 2 vr 540dq - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Tocris
u0126 mek inhibitor ![]() U0126 Mek Inhibitor, supplied by Tocris, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc07306006-26-0-4?v=Tocris Average 96 stars, based on 1 article reviews
u0126 mek inhibitor - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
dna ladder ![]() Dna Ladder, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc10421768-209-2-7?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
dna ladder - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Sartorius AG
cationic polymer transfection reagent in vivo jetpei ![]() Cationic Polymer Transfection Reagent In Vivo Jetpei, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc04877447-135-1-12?v=Sartorius+AG Average 91 stars, based on 1 article reviews
cationic polymer transfection reagent in vivo jetpei - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6 entry mouse mlh1 origene ![]() Pcmv6 Entry Mouse Mlh1 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pm33338427-205-151-153?v=OriGene Average 90 stars, based on 1 article reviews
pcmv6 entry mouse mlh1 origene - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
human bmi1 cdna ![]() Human Bmi1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+concentration+quanti+ed/pmc04411128-34-0-8?v=OriGene Average 90 stars, based on 1 article reviews
human bmi1 cdna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: Human TMEM30a partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae
Article Snippet:
Techniques:
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.
Article Snippet:
Techniques: Transformation Assay, Plasmid Preparation, Expressing, Flow Cytometry, Concentration Assay
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).
Article Snippet:
Techniques: Flow Cytometry, Transformation Assay, Plasmid Preparation, Quantitation Assay, Sequencing, Western Blot, Isolation, Expressing, Concentration Assay, Construct
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.
Article Snippet:
Techniques: Stable Transfection, Transfection, Staining, Confocal Microscopy, Expressing, Labeling, Western Blot, Flow Cytometry, Incubation
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”
Article Snippet:
Techniques: Transfection, Plasmid Preparation, Confocal Microscopy, Expressing, Flow Cytometry
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.
Article Snippet:
Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, shRNA, Expressing, Quantitation Assay
Journal:
Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells
doi: 10.4049/jimmunol.1002710
Figure Lengend Snippet: (A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.
Article Snippet:
Techniques: Fluorescence, Concentration Assay, Plasmid Preparation, shRNA, Transfection, Functional Assay
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: Proproliferative fibroblast phenotype and paracrine smooth muscle proliferation mediated by p38 MAPK in fibroblasts from experimental models of pulmonary hypertension (PH). A : cells were isolated from the 2nd order division of the pulmonary artery and grown in normoxic culture. The effect of serum stimulation was observed on these cells. At baseline with no serum stimulation, the chronic hypoxic (CH) and monocrotaline (MCT) pulmonary artery fibroblast (PAF) had an increased proliferative rate compared with the PAF derived from normoxic wild-type rats. This was also seen with low dose 1% serum stimulation. The effect was lost at 5% serum stimulation, which may reflect cell contact inhibition. The thymidine incorporation assay was used to assess the proliferation of the cells, and the results presented are representative of 3 experiments with triplicate values in each experiment. Values are means ± SE. *** P < 0.001. B : this immunoblot shows that under normoxic conditions the PAFs derived from both CH and MCT animals show a constitutive activation of p38 MAPK with increased levels of p-p38 detected. Cells were from passage 3 and were quiescesed in serum free medium for 24 h before harvest. Immunoblot for phospho-p38 and total p38 MAPK was performed and representative of 3 experiments. C : PAFs derived from MCT animals were isolated and then quiescesed for 24 h in serum free media. After 24 h, cells were stimulated with either 1% serum or some remained in serum free media ± SB203580 (p38 inhib). The conditioned media were aspirated from the wells after 24 h and passed through a cell sieve to give conditioned media from serum free cells ± SB203580 (SF cond med, SF cond med + p38 inhib) and 1% stimulated cells ± SB203580 (1% cond med, 1% cond med + p38 inhib). The conditioned media were added to smooth muscle cells for 48 h before a proliferation assay was performed. Both SF cond med and 1% cond med resulted in increased proliferation of pulmonary artery smooth muscle cells (PASMCs) while this effect was lost in the conditioned media from the PAFs, which had been coincubated with SB203580. There was no effect of SB203580 directly on the PASMCs. Values are means ± SE. Data shown from 3 experiments. ** P < 0.005. D : PAFs derived from CH animals were isolated and then quiescesed for 24 h in serum free media. After 24 h, cells were stimulated with either 1% serum or some remained in serum free media ± SB203580 (p38 inhib). The conditioned media were aspirated from the wells after 24 h and passed through a cell sieve to give conditioned media from serum free cells ± SB203580 (SF cond med, SF cond med + p38 inhib) and 1% stimulated cells ± SB203580 (1% cond med, 1% cond med + p38 inhib). The conditioned media were added to normal PASMCs for 48 h before a proliferation assay was performed. Both SF cond med and 1% cond med resulted in increased proliferation of PASMCs while this effect was lost in the conditioned media from the PAF, which had been coincubated with SB203580. There was no effect of SB203580 directly on the PASMCs. Values are means ± SE. Data shown from 3 experiments. * P < 0.05; ** P < 0.005. E : PAF from normal animals were exposed to 48 h normoxia or hypoxia ± SB203580. The supernatant was collected and analyzed using cytokine array. The above are representative of triplicate samples from 3 different animals. Exposure times for each blot was the same. The results for IL-6 are shown and are presented as a relative density plot vs. the positive control blots. *** P < 0.005. F : PASMCs are quiescesed and then incubated with conditioned media derived from normoxic or hypoxic PAF. The hypoxic conditioned media induced PASMC proliferation. When both the conditioned media and anti-IL-6 were added to the PASMCs, there was an inhibition in the proliferative stimulus. Results are means ± SE from 3 replicates from 3 different animals. *** P < 0.001.
Article Snippet: The
Techniques: Isolation, Derivative Assay, Inhibition, Thymidine Incorporation Assay, Western Blot, Activation Assay, Proliferation Assay, Positive Control, Incubation
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: Increased expression of p38 MAPK α-isoform in animal models of PH. A : lungs from normal, CH, and MCT animals were harvested and homogenized with a cocktail of phosphatase and kinase inhibitors. The protein concentration was quantified using the BCA method. Equal concentrations were then loaded on a gel and blotted for p38 MAPKα and β-actin for loading control. There are 3 wells for each condition. Immunoblot shown is best representative of 3 experiments using 3 different animals with each condition. B : densitometry of immunoblot in A . Values are mean arbitrary values from 3 immunoblots expressed relative to the value for β-actin. * P < 0.05 by ANOVA. C : lung sections (5 mm) were prepared from normal, CH, and MCT animals. Sections were stained for p38 MAPKα using 1:400 dilution. Magnification: ×20. Bar represents = 150 mm. Arrows identify blood vessels. D : lungs from normal, CH, and MCT animals were harvested and homogenized with a cocktail of phosphatase and kinase inhibitors. The protein concentration was quantified using BCA method. Equal concentrations were then used in a p38 MAPK activity assay using immunoprecipitation and the phosphorylation of activating transcription factor-2 (ATF-2) as a read out. Immunoblot shown is representative of 3 experiments using 3 different animals. E and F : lungs from normal, CH, and MCT animals were harvested and homogenized with a cocktail of phosphatase and kinase inhibitors. The protein concentration was quantified using BCA method. Equal concentrations were then loaded on a gel and blotted for phosphorylated p38 MAPK and β-actin for loading control. Immunoblot shown is representative of 3 experiments using 3 different animals with each condition. Densitometry is shown for remaining blots. * P < 0.05.
Article Snippet: The
Techniques: Expressing, Protein Concentration, Control, Western Blot, Staining, Activity Assay, Immunoprecipitation, Phospho-proteomics
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: PH is prevented by administration of SB203580, a p38 MAPKα inhibitor. A and B : animals were exposed to a hypobaric hypoxic environment for 2 wk. Some animals received daily injections of SB203580. Hemodynamics ( A ) and hematocrit ( B ) were measured after 2 wk. RVSP, right ventricular (RV) systolic pressure. Data represent mean values ± SE. Total animals n = 5–6 per group. C : hearts were isolated from the animals and the RV was dissected out from the left ventricle (LV) and septum. The ventricles were dry blotted and then weighed, and the ratio was calculated. The total RV weight was also plotted. Values are means ± SD; n = 5 per group. ** P < 0.05. D : noninvasive systemic blood pressure taken by tail-cuff measurement. E and F : rats were exposed to hypoxia ± SB203580. The lungs were removed after experiment and sections (5 mm) cut. These were stained with α-smooth muscle actin and the vessels <80 mm were analyzed for degree of muscularization. Five random fields per slide were analyzed with 3 slides per animal. The vessels were categorized as completely, partially, or nonmuscularized and are presented as numbers per total number of vessels present in each field. Groups analyzed by ANOVA for overall change with posttest analysis; n = 5 animals. *** P < 0.001, for A – C and E .
Article Snippet: The
Techniques: Isolation, Staining
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: PH in 2 in vivo animal models is reversed by the administration of SB203580, a p38 MAPKα inhibitor. A : animals were exposed to a hypobaric hypoxic environment for 2 wk and then p38 MAPK inhibition was commenced. Hemodynamics and RVSP were measured after 4 wk. Data represent mean values ± SE. Total animals n = 5–6 per group. ** P < 0.01; *** P < 0.001, for normal relative to all other conditions. B : hearts were isolated form the animals and the RV dissected out from the LV and septum. The ventricles were dry blotted and then weighed, and the ratio was calculated. Values are means ± SE; n = 6–7. ** P < 0.01; *** P < 0.005. C : hematocrit ratio. D : the lungs were removed after experiment and sections (5 mm) cut. These were stained for α-smooth muscle actin and the vessels <80 mm were analyzed for degree of muscularization. Five to 10 random fields were analyzed with 3 slides per animal. The vessels were categorized as completely, partially, or nonmuscularized. Groups analyzed by ANOVA for overall change with posttest analysis; n = 6 animals. ** P < 0.01; *** P < 0.001. E : the lungs were removed after experiment and sections (5 mm) cut. These were stained for α-smooth muscle actin and the vessels <100 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as muscularized or nonmuscularized and the percentage of muscularized vessels calculated. Groups were analyzed by ANOVA for overall change with posttest analysis; n = 7 animals. **** P < 0.0001; ■ P < 0.05 for hypoxic drug-treated vs. day 14 hypoxic control. ** P < 0.01; *** P < 0.001. F and G : animals were injected with MCT and after 2 wk p38 MAPK inhibition was commenced with daily injections. Hemodynamics and RVH were measured after 4 wk. Data represent mean values ± SE. Total animals n = 6–7 per group. * P < 0.05; *** P < 0.001, for F . * P < 0.05; ** P < 0.01, for G . H : the lungs were removed after experiment and sections (5 mm) cut. These were stained for α-smooth muscle actin, and the vessels <80 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as completely, partially or nonmuscularized. Groups were analyzed by ANOVA for overall change with posttest analysis; n = 6 animals. * P < 0.05; *** P < 0.001. I : lungs were removed after experiment and sections (5 mm) cut. These were stained for α-smooth muscle actin, and the vessels <100 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as muscularized or nonmuscularized, and the percentage of muscularized vessels was calculated. Groups were analyzed by ANOVA for overall change with posttest analysis; n = 6 animals. **** P < 0.0001; ■ P < 0.05 for hypoxic drug-treated vs. day 14 MCT control.
Article Snippet: The
Techniques: In Vivo, Inhibition, Isolation, Staining, Control, Injection
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: PH in a reversal strategy in 2 in vivo animal models by administration of PH-797804, a more selective p38 MAPKα inhibitor. A and B : animals were exposed to CH and after 2 wk p38 MAPK inhibition was commenced with daily injections. Hemodynamics and RV hypertrophy (RVH) were measured after 4 wk. Data represent mean values ± SE. * P < 0.05; ** P < 0.01 for A . ** P < 0.01; *** P < 0.001, for B . C : the lungs were removed after experiment and sections (5 mm) were cut. These were stained with α-smooth muscle actin and the vessels <80 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as completely, partially, or nonmuscularized. Groups analyzed by ANOVA for overall change with posttest analysis; n = 10 animals. ** P < 0.01; ■ P < 0.05 for complete muscularized group in drug-treated vs. day 14 hypoxic control. D : lungs were removed after experiment and sections (5 mm) cut. These were stained with α-smooth muscle actin and the vessels <100 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as muscularized or nonmuscularized and the percentage of muscularized vessels calculated. Groups analyzed by ANOVA for overall change with posttest analysis; n = 10 animals. **** P < 0.0001; ■ P < 0.05 for hypoxic drug-treated vs. day 14 hypoxic control. E and F : animals were injected with MCT and after 2 wk p38 MAPK inhibition was commenced with daily injections. Hemodynamics and RVH were measured after 4 wk. Data represent mean values ± SE. Total animals n = 14–15 per group. *** P < 0.001 for E . * P < 0.05; ** P < 0.01 for F . G : the lungs were removed after experiment and sections (5 mm) cut. These were stained with α-smooth muscle actin and the vessels <80 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as completely, partially or nonmuscularized. Groups analyzed by ANOVA for overall change with posttest analysis; n = 10 animals. ** P < 0.01; ■ P < 0.05, for complete muscularized group in drug-treated vs. day 14 hypoxic control. H : lungs were removed after experiment and sections (5 mm) cut. These were stained with α-smooth muscle actin, and the vessels <100 mm were analyzed for degree of muscularization. Five to 10 random fields (×40) were analyzed with 3 slides per animal. The vessels were categorized as muscularized or nonmuscularized, and the percentage of muscularized vessels was calculated. Groups analyzed by ANOVA for overall change with posttest analysis; n = 10 animals. **** P < 0.0001; ■ P < 0.05 for drug-treated vs. day 14 MCT control.
Article Snippet: The
Techniques: In Vivo, Inhibition, Staining, Control, Injection
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: p38 MAPKα inhibition reduces interleukin (IL)-6 generation and signaling as a potential mechanism for beneficial effects in PH. A and B : supernatant from normoxic and hypoxic PAF ± SB203580 was analyzed using a quantitative ELISA to determine actual amounts released. Cells were growth arrested in serum free media for 24 h before hypoxic exposure. The values are mean ± SE values from triplicate wells for each sample and experiment repeated 3 times using cells from 3 animals. * P < 0.05 ** P < 0.005. C : PAF were exposed to hypoxia and then RNA isolated after 48 h. The RNA was reverse transcribed into cDNA and then analyzed using quantitative (q)RT-PCR. The mRNA increased and peaked at 12 h of hypoxia. Values represent ratio of increase of IL-6 gene mRNA relative to the housekeeping gene of β-actin and calculated using comparative Ct method. Values are representative of triplicate samples from 3 experiments using 3 different animals. D : PAF were exposed to hypoxia in the presence of SB203580 and then RNA isolated after 48 h. The RNA was reverse transcribed into cDNA and then analyzed using qRT-PCR. The mRNA increased and peaked at 12 h of hypoxia. Values represent ratio of increase of IL-6 gene mRNA relative to the housekeeping gene of β-actin and calculated using comparative Ct method. Values are representative of triplicate samples from 3 experiments using 3 different animals. ** P < 0.01; *** P < 0.01, for C and D . E : PAF were isolated and incubated with IL-6 (100 ng/ml) ± soluble IL-6 receptor (sIL-6) and then using DNA synthesis as a marker of cell proliferation, the response was observed. Data are mean values ± SE and are representative of duplicate experiments performed on cells from 3 different animals. * P < 0.05; ** P < 0.005; *** P < 0.0001. F : PASMCs were exposed to IL-6 (100 ng/ml) ± soluble IL-6 receptor (sIL-r) and then using DNA synthesis as a marker of cell proliferation, the response was observed. Data are means ± and are representative of duplicate experiments performed on cells from 3 different animals. **** P < 0.0001. G : PASMCs were growth arrested for 24 h and then incubated with serum free media, IL-6 or IL-6 and anti-IL-6 antibody. Thymidine assay was used to quantify DNA synthesis, a measure of cell proliferation. Results are plotted as counts per million. Values are means ± SE and represent mean of 3 experiments on cells from same animal. A total of 3 different animals were used. ** P < 0.01. H and I : PASMCs were stimulated with 100 ng/ml IL-6 (+) or without (−) and the protein harvested at baseline, 15 min, 30 min, 1 h, and 4 h. The cell lysates were immunoblotted for phosphorylated STAT3 and total STAT3. Experiment was repeated 3 times; blots above are representative of those experiments. H shows densitometry from repeat blots. *** P < 0.005; **** P < 0.001, for I .
Article Snippet: The
Techniques: Inhibition, Enzyme-linked Immunosorbent Assay, Isolation, Reverse Transcription, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Incubation, DNA Synthesis, Marker
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: p38 MAPK inhibition in vivo leads to reduced IL-6 in experimental models of PH. A : lungs were isolated from CH animals in the prevention study with SB203580 and homogenized. The protein concentration was normalized by protein concentration as per BCA method. ELISA was used to analyze for IL-6 levels in the lung tissue. Data shown are means ± SE from triplicate samples from 4/5 animals in each group. B : lungs were isolated from normal and CH animals after treatment in reversal strategy with SB203580 and homogenized. The protein concentration was normalized by protein concentration as per BCA method. ELISA was used to analyze for IL-6 levels in the lung tissue. Drug-treated and normal control animals are at 28 days. Data shown are means ± SE from triplicate samples from 4/5 animals in each group. * P < 0.05 ** P < 0.01. C and D : lungs from CH 28-day controls and SB203580 -treated hypoxic animals were harvested and homogenized with a cocktail of phosphatase and kinase inhibitors. The protein concentration was quantified using BCA method. Equal concentrations were then loaded on a gel and blotted for phospho-STAT3 and total STAT3. Immunoblot shown is best representative of 3 experiments using lungs from 3 different animals with each condition. Densitometry is shown of other blots. ** P < 0.001. E : lungs were isolated from MCT and normal control animals and homogenized. Inhibitor used was SB203580. The protein concentration was normalized by protein concentration as per BCA method. ELISA was used to analyze for IL-6 levels in the lung tissue. Data shown are means ± SE from triplicate samples from 4/5 animals in each group. * P < 0.05; ns is not significant by ANOVA. F : PH-797804 reduces serum IL-6 in reversal of CH-induced PH. Serum was collected from animals at the time of cardiac puncture and stored at −80°C until analysis could be performed. ELISA for IL-6 was performed on serum samples. Values shown are means ± SE. Samples were analyzed in duplicate and total animal number n = 11. *** P < 0.005. G : PH-797804 reduces serum IL-6 in reversal of MCT-induced PH. Serum was collected from animals at the time of cardiac puncture and stored at −80°C until analysis could be performed. ELISA for IL-6 was performed on serum samples. Values shown are means ± SE. Samples were analyzed in duplicate and total animal number n = 12. * P < 0.01; *** P < 0.005. H : fibroblasts undergo phenotypic switch back to normal after p38 MAPK inhibition. PAF were cultured from pulmonary arteries derived from normal, experimental models of PH (CH and MCT) and from animals after treatment with p38 MAPK inhibition PH-787904 for 2 wk. Cells were challenged with or without serum to assess proliferation; n = 3–4 per group. Experiment repeated 3 times. ** P < 0.01, *** P < 0.001.
Article Snippet: The
Techniques: Inhibition, In Vivo, Isolation, Protein Concentration, Enzyme-linked Immunosorbent Assay, Control, Western Blot, Cell Culture, Derivative Assay
Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology
Article Title: The reversal of pulmonary vascular remodeling through inhibition of p38 MAPK-alpha: a potential novel anti-inflammatory strategy in pulmonary hypertension
doi: 10.1152/ajplung.00038.2015
Figure Lengend Snippet: Phospho-p38 MAPK and p38 MAPKα expression in explanted lungs from patients with idiopathic pulmonary arterial hypertension (IPAH). A : sections of 5 mm were taken. Then, normal control lung and IPAH lung are stained for phospho-p38 MAPK at dilution of 1:300. The isotype on IPAH lung is also shown. This dilution was optimally assessed for. Objective: ×20. Bar = 150 mm. B : high-power microscopy shows that there is strong staining for phospho-p38 MAPK in the intima, media, and the adventitia (arrows). Objective lens: ×20 and ×40. Bar = 50 mm. C : sections of control lung ( A ) and IPAH lung ( B ) were stained for p38 MAPKα at dilution of 1:300. Objective lens × 20. Bar = 150 mm. D : staining for p38 MAPKa showed increased cytosolic staining in the IPAH lung ( right ) compared with control lung ( left ). E : high-power view (×40) of staining with isotype and p38 MAPKα in a vessel in IPAH lung. This shows staining throughout the vessel layers but especially in adventitia and fibroblast cells (arrow). Bar = 50 mm. F : low-power view of a plexiform lesion. Staining for p38 MAPKα using 1:300 dilution. Objective lens × 20. Bar = 150 mm. G : histological scoring shows increased p38 MAPKα staining throughout the vascular wall. With the use of a well-validated histological scoring system (Allred), the vascular wall cells were scored for intensity of staining. The intensity multiplied by the number of vessels with that intensity determines the values. Values shown are from 5 random high-power fields from 2 slides. **** P < 0.0001 by ANOVA. ** P < 0.001 for individual IPAH vs. control columns.
Article Snippet: The
Techniques: Expressing, Control, Staining, Microscopy
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: (a) A Clock and Wavefront model: antagonistic gradient of Fgf8 (originating from the posterior PSM, green) and RA (originating from the somites, violet) define a wavefront which interacts with a particular phase of the segmentation clock (in the PSM, red) to generate somites at periodic times and positions. (b) Kymograph of somitogenesis from 7 to 20 somites. The tail elongates at a constant rate V tail while the PSM shrinks at a roughly constant rate V PSM resulting in a somite wavefront propagating at a rate V front = V tail -V PSM .
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques:
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: Molecular models of the determination wavefront. (a) The Goldbeter, Gonze and Pourquié (G 2 P) model assumes that RA directly affects the translation of Fgf8 mRNA into protein, while Fgf8 represses RA via the activation of its degradation enzyme Cyp26. (b) The modified version of the G 2 P model (mG 2 P) proposed here takes into account the observed positive feedbacks of RA on Fgf8 and of Fgf8 on RaldH and the mutual inhibition of RA on MapK (via the RA-mediated activation of Mkp3) and of MapK on RA (via the MapK-controlled activation of Cyp26). (c) Both models predict a bistability of MapK activity for a certain positional range (in grey).
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Activation Assay, Modification, Inhibition, Activity Assay
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: Time of appearance of somites (t=0 at 7 somites stage). Notice the linearity of the plot, i.e. the regularity of the period of somitogenesis, in all the conditions studied here: WT (n=8), DEAB (an inhibitor of RaldH; with (n=14) or without (n=12) external RA), morpholinos against Fgf8 (MO-Fgf8; n=16), BCI (an inhibitor of Mkp3; n=16) or activation of exogenous Fgf8 (n=17).
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Activation Assay
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: (a) Staining of phosphorylated MapK by antibodies against this active form in WT embryos at 10 and 15 somites. Notice the smaller domain of activity at 15s as compared to 10s. (b) The data in was quantified by measuring the fluorescence intensity in a single embryo along the antero-posterior axis and averaged over n=17 (10s) and n=21 (15s) embryos. The averaged data is compared to simulations of the mG 2 P model with the parameters of assuming an exponential decrease (see ) between 7s and 10s (or 15s) of the mRNA Fgf8. The x and y-scales were chosen to fit the data at 10s. The simulation results are in qualitative agreement with the data, even though the latter might not be a perfect reflection of the MapK activity level (which depends on the efficiencies of staining and washing).
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Staining, Activity Assay, Fluorescence
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: (a) Variation with time of Fgf8 concentration versus somite stage and fit to an exponential decay past 5 somites stage. (b) PSM shortening from 7 somites stage (dots and error bars on mean; n=8) and results (continuous line) of a simulation of the mG 2 P model (with the displayed parameters and assuming an exponential decay of Fgf8 with the timescale measured in (a)). Details in Supp.Mat.
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Concentration Assay
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: Rates of PSM shrinkage (V PSM ), tail growth (V tail ) and wavefront velocity (V front ) in embryos growing (a) without or with morpholinos against Fgf8 (MO-Fgf8; dots and error bars on mean; n=16) injected at one-cell stage or (b) in which an exogenous source of Fgf8 was turned on (n=17). While V PSM is unaffected by MO-Fgf8 and slightly decreases upon over-expression of Fgf8 (in the strong phenotype 2 embryos), V tail decreases in both conditions, resulting in an overall decrease of V front . Continuous lines: simulations of the mG 2 P model with a 60% decrease in Fgf8 mRNA (due to interference with MO-Fgf8; γ=0.8 instead of γ=2 in model, see Supp.Mat.) qualitatively reproduce the data (continuous line in (a)). Similarly simulations with an increasing Fgf8 mRNA of about 2% of the measured increase (see Fig.S7) seem to reproduce the data observed in the strong phenotype 2 case (see Supp.Mat. Fig.S5).
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Injection, Over Expression
Journal: bioRxiv
Article Title: Quantitative study of the somitogenetic wavefront in zebrafish
doi: 10.1101/419705
Figure Lengend Snippet: (a,c) MapK activity at steady-state from a simulation of mG 2 P model with the parameters shown in the figures and linear gradients of RaldH (parameter α) and Fgf8 mRNA (parameter γ). Notice the existence of a bistability window (between distances: −40 and −32 in (c)). (b,d) Variation with time of the distance from the tail end (at 0) of the rightmost bistability boundary (red vertical line in (a,c)): assuming linear decrease with time of Fgf8 mRNA (red curve; t ∼ 1 - mF0(t)/mF(0)) or exponential decrease with time of Fgf8 mRNA (blue curve, mF0(t) = mF0(0) e -t ). (e,f) Results of simulations with linear gradients of Cyp26 (parameter β) and Fgf8 mRNA (parameter γ). Notice that the MapK activity levels off at the tail end though a bistability window is still present. (g,h) Results of simulations with a linear gradient of Fgf8 mRNA (parameter γ) only. Notice the increasing MapK activity level and the increased PSM shrinkage rate at the tail end (even assuming an exponential decay with time of FgF8 mRNA).
Article Snippet: RT-qPCR was performed using the aforementioned cDNAs with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assay: Dr03119263_m1(rpl13a) and Dr03105657_m1(
Techniques: Activity Assay
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Characterization of the Vpr/UNG2/RPA32 molecular complex. a , b In vitro binding analyses of Vpr/UNG2/RPA32 interactions. 293T cells were cotransfected with plasmids for expression of HA-tagged forms of Vpr, UNG2 and RPA32. Lysates from transfected cells were then incubated with 5 µg of GST, GST-UNG2 ( a ) or GST-RPA32 ( b ) immobilized on GSH-Sepharose beads. Bound proteins were resolved by SDS-PAGE and analyzed by Western blot with anti-HA and anti-β-actin antibodies. Equal amount of cell lysate proteins from transfected cells was run as control on the left panels . c Co-immunoprecipitation of the Vpr/UNG2/RPA32 complex. 293T cells were tranfected with the HA-Vpr expression plasmid or the control plasmid (mock). Cells were lyzed 48 h later and Vpr was precipitated with anti-HA antibody. Immunoprecipitates ( right panels ) and cell lysates ( left panels ) were then analyzed by Western blotting with anti-HA, anti-UNG2, anti-RPA32 and anti-β-actin antibodies. d Schematic representation of UNG2 showing the interaction domains with Vpr and the RPA32 (p32) subunit of the RPA complex. The 231–234 WxxF motif of UNG2 (indicated in blue ) interacts with Vpr while the N-terminal part of UNG2 encompassing amino-acids 73–84 (in green ) contains determinants for RPA32 binding [ , , ]
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: In Vitro, Binding Assay, Expressing, Transfection, Incubation, SDS Page, Western Blot, Immunoprecipitation, Plasmid Preparation
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 depletion on HIV-1 replication in HeLa-CD4 cells. a Depletion of UNG2 and RPA32 in 293T ( left panels ) and HeLa-CD4 ( right panels ) cells. Cells were transduced with lentiviral vectors expressing shRNA against UNG2, RPA32 or Luciferase (Luc) used as a control. Lysates from shRNA-transduced cells were analyzed by Western blot using anti-UNG2, anti-RPA32, anti-RPA70 and anti-β-actin antibodies. b , c Virus replication in UNG2- or RPA32-depleted cells. Replication-competent viruses were produced in UNG2-, RPA32-depleted or in control shLuc 293T cells, normalized for viral p24, and then used for infection of UNG2-depleted ( red line and bars ), RPA32-depleted ( green line and bars ) or control shLuc ( black line and bars ) HeLa-CD4 cells. Aliquots of cell culture supernatant were collected 2, 4, and 8 days after infection for p24 quantification. In b , the kinetic of replication shown is representative of four independent experiments. In c , results are the means of the four independent experiments and are expressed as the percentage of p24 production at each time point relative to that of shLuc-transduced HeLa-CD4 cells infected with control viruses. d Virus infectivity. Wild-type GFP reporter viruses were produced in shUNG2-, shRPA32- or shLuc-transduced 293T cells, normalized for p24, and then used to infect shUNG2-, shRPA32- or shLuc-transduced HeLa-CD4 cells as indicated. The percentage of GFP-positive infected cells was then measured by flow cytometry 60 h later. Viral infectivity was normalized to that of viruses produced in control 293T cells and measured on control HeLa-CD4 as target cells. e Quantification of total viral DNA. Infected HeLa-CD4 cells were collected 7 h after infection, subjected to DNA purification, and the total viral DNA was quantified by qPCR using specific primers for U5 - gag . Results are expressed as the percentage of total viral DNA relative to that of shLuc-transduced HeLa-CD4 cells infected with control viruses produced in shLuc-transduced 293T cells. Values are the means of at least three independent experiments. Error bars represent 1 SEM (standard error of the mean). Statistical significance was determined using Students t test (ns, p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Transduction, Expressing, shRNA, Luciferase, Western Blot, Produced, Infection, Cell Culture, Flow Cytometry, DNA Purification
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 on HIV-1 replication in Jurkat T cells. a Depletion of UNG2 and RPA32 in Jurkat cells. Cells were transduced with lentiviral vectors expressing shRNA against UNG2, RPA32 or Luciferase. Lysates from shRNA-transduced cells were analyzed by Western blot using anti-UNG2, anti-RPA32, anti-RPA70 and anti-β-actin antibodies. b – e Virus replication in UNG2- or RPA32-depleted Jurkat cells. Replication-competent viruses were produced in UNG2- (B and D) or RPA32- ( c , e ) depleted cells or in control shLuc-transduced 293T cells, normalized for p24, and then used for infection of shLuc-, shUNG2- or shRPA32-transduced Jurkat cells. Aliquots of cell culture supernatant were collected 2, 4, and 8 days after infection for p24 quantification. In b , c , the kinetic of replication shown is representative of four independent experiments. In d , e , values are the means of the four independent experiments. Results are expressed as the percentage of p24 production at each time point relative to that of shLuc-transduced Jurkat cells infected with viruses produced in shLuc-transduced 293T cells. f Virus infectivity in UNG2- and RPA32-depleted cells. Wild-type GFP reporter viruses were produced in shUNG2-, shRPA32- or shLuc-transduced 293T cells, normalized for p24, and then used to infect shUNG2-, shRPA32- or shLuc-transduced Jurkat cells as indicated. The percentage of GFP-positive infected cells was then measured by flow cytometry 60 h later. Viral infectivity was normalized to that of viruses produced in shLuc-transduced 293T cells and measured on shLuc-transduced Jurkat as target cells. Error bars represent the SEM. Statistical significance was determined by using the Students t test (ns, p > 0.05; *p < 0.05; **p < 0.01)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Transduction, Expressing, shRNA, Luciferase, Western Blot, Produced, Infection, Cell Culture, Flow Cytometry
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: UNG2 and RPA32 expression in human cell lines and primary cells. Primary monocytes and PBMCs were isolated from blood of healthy donors. While PBMCs were activated in culture medium supplemented with PHA for 72 h and then IL-2 for 48 h, monocytes were differentiated in macrophages for 7 days in culture medium supplemented with M-CSF. a UNG2 and RPA32 protein expression. Equivalent amounts of proteins from total lysates of 293T, HeLa-CD4 and Jurkat cells, monocytes and macrophages, and non-activated and activated PBMCs (NA and A, respectively) were resolved by SDS-PAGE and analyzed by Western blotting with anti-UNG, anti-RPA32 and anti-β-actin antibodies. b , c Quantification of UNG2 and RPA32 mRNA expression. RNA was extracted and purified from 293T, HeLa-CD4, Jurkat cells, monocytes, macrophages, and non-activated and activated PBMCs, and UNG2 ( b ) and RPA32 ( c ) mRNA expression levels were then measured by quantitative RT-qPCR. Results are expressed as the percentage of UNG2 and RPA32 mRNA copies relative to those measured from 293T cell RNA extract. Data shown are means of three independent experiments (293T, HeLa and Jurkat cells) or from three independent donors for PBMCs and MDMs, performed in duplicate. Error bars represent 1 standard deviation (SD) from the mean. The inset graphs focus on mRNA expression levels in the primary cells. Negative control corresponds to 293T RNA extract processed without reverse transcriptase in the reaction mixture. ND no detection
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Expressing, Isolation, SDS Page, Western Blot, Purification, Quantitative RT-PCR, Standard Deviation, Negative Control
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 on HIV-1 replication in PBMCs. a – c Viral replication. Replication-competent viruses were produced in shLuc- ( black curves and bars ), shUNG2- ( red curves and bars ) or shRPA32- ( green curves and bars ) transduced 293T cells, normalized for p24, and then used for infection in duplicate of PBMCs from five different healthy blood donors. Aliquots of PBMC culture supernatant were collected 2, 4 and 8 days after infection for p24 quantification. In a , the individual kinetics of replication in PBMCs from the five healthy donors are shown. In b , results are expressed as the percentage of p24 production at each time point relative to that of PBMCs infected with viruses produced in shLuc-transduced ( black bars ) 293T cells. Values are the means of two independent experiments performed on PBMCs from the five healthy donors. In c , PBMCs were collected 7 h after infection, subjected to DNA purification, and total viral DNA was quantified via qPCR using specific primers for U5 - gag . Results are expressed as the percentage of total viral DNA relative to that of PBMCs infected with viruses produced in shLuc-transduced ( black bar ) cells. d Virus infectivity. GFP reporter viruses were produced in shUNG2-, shRPA32- or shLuc-transduced 293T cells as indicated, normalized for p24, and then used to infect PBMCs from three different donors. The percentage of GFP-positive infected cells was then measured by flow cytometry 60 h later. Viral infectivity was normalized to that of viruses produced in shLuc-transduced 293T cells. Error bars represent the SEM. Statistical significance was determined by using the Students t test (ns, p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Produced, Infection, DNA Purification, Flow Cytometry
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 on HIV-1 replication in macrophages. a – c Wild-type ( a ) or Δ vpr ( b ) replication-competent viruses were produced in shLuc- ( black curves and bars ), shUNG2- ( red curves and bars ) or shRPA32- ( green curves and bars ) transduced 293T cells, normalized for p24, and then used for infection in duplicate of MDMs from 3 different healthy donors. In a and b , aliquots of MDM cell culture supernatants were collected 4 and 8 days after infection for p24 quantification. The individual kinetics of replication in PBMCs from the three healthy donors are shown. In c , results are expressed as the percentage of p24 production at each time point relative to that of MDMs infected with wt or Δ vpr viruses produced in shLuc-transduced ( black bars ) cells. Values are the means of two independent experiments performed on MDMs from the two donors. d Virus infectivity in MDMs. Wild-type GFP reporter viruses were produced in shUNG2-, shRPA32- or shLuc-transduced 293T cells, normalized for p24, and then used to infect MDMs from three different donors. The percentages of GFP-positive infected cells were then measured by flow cytometry 60 h later. Viral infectivity was normalized to that of viruses produced in shLuc-transduced ( black bars ) 293T cells. e Replication-competent viruses were produced in shLuc-, shUNG2- or shRRA32-transduced 293T cells, normalized for p24, and then used for infection of MDMs from three different donors. MDM samples were collected 72 h after infection, subjected to DNA purification, and total viral DNA was quantified via qPCR using specific primers for U5 - gag . Results are expressed as the percentage of total viral DNA relative to that of MDMs infected with viruses produced in shLuc-transduced ( black bar ) cells. f Double-depletion of UNG2 and RPA32 expression in virus-producing 293T cells. Cells were transduced with lentiviral vectors expressing shRNA against UNG2 or Luciferase and containing the gene for puromycin resistance, and with lentiviral vectors expressing shRNA against RPA32 or Luciferase and the GFP reporter gene. Lysates from shRNA-transduced cells were analyzed by Western blot using anti-UNG2, anti-RPA32 and anti-β-actin antibodies. g Replication-competent viruses were produced in shLuc/shLuc-GFP ( black bar ), in shUNG2/shLuc-GFP ( red bar ) or in shUNG2/shRPA32-GFP ( red and green hatched bar ) 293T cells, normalized for p24, and then used for infection of MDMs from three different healthy donors. The concentration of p24 after 8 days of infection was expressed as the percentage of p24 production relative to that of MDMs infected with viruses produced in shLuc-transduced ( black bar ) cells. Error bars represent the SEM. Statistical significance was determined using Students t test (ns, p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Produced, Infection, Cell Culture, Flow Cytometry, DNA Purification, Expressing, Transduction, shRNA, Luciferase, Western Blot, Concentration Assay
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 for dissemination of cell-free virus particles between T cells and MDMs. a Schematic representation of the experimental system. shLuc, shUNG2- or shRPA32-transduced Jurkat cells were infected with HIV-1 (YU2 strain) expressing the VSV-G envelope, and the cell culture supernatant was then collected 3 days later. After p24 normalization, cell-free viruses produced by shRNA-transduced Jurkat cells were used for infection of MDMs, and virus production was monitored after infection. b and c Replication in MDMs of Jurkat cells-produced viruses. Replication-competent viruses were produced in shLuc-, shUNG2- or shRPA32-transduced Jurkat cells and then used to infect MDMs. Aliquots of cell culture supernatants were collected 4 and 8 days after infection for p24 quantification. In b , the individual kinetics of replication in MDMs from three different donors of viruses produced in shUNG2- or shRPA32-tranduced Jurkat cells are shown. In c , results are expressed as the percentage of p24 production at each time point relative to that of MDM cells infected with control viruses. Values are the means of two independent experiments performed with MDMs from three different donors. Error bars represent the SEM. Statistical significance was determined using Students t test (ns, p > 0.05; *p < 0.05)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Infection, Expressing, Cell Culture, Produced, shRNA
Journal: Retrovirology
Article Title: Uracil DNA glycosylase interacts with the p32 subunit of the replication protein A complex to modulate HIV-1 reverse transcription for optimal virus dissemination
doi: 10.1186/s12977-016-0257-x
Figure Lengend Snippet: Impact of UNG2 and RPA32 for dissemination of cell-free virus particles between MDMs and Jurkat T cells. a Schematic representation of the experimental system. MDMs were infected with replication-competent HIV-1 (NL4.3 strain) co-expressing the VSV-G envelope, and the cell culture supernatant was then collected 8 days later. After p24 normalization, cell-free viruses produced by MDMs were used for infection of shLuc-, shUNG2- or shRPA32-transduced Jurkat cells, and virus production was monitored after infection. b and c Replication in Jurkat cells of MDMs-produced viruses. Replication-competent viruses were produced in MDMs and then used for infection of shLuc- ( black lines and bars ), shUNG2- ( red lines and bars ) or shRPA32- ( green lines and bars ) transduced Jurkat cells. Aliquots of cell culture supernatants were collected 2, 4 and 8 days after infection for p24 quantification. In b , the individual kinetics of replication in shRNA-tranduced Jurkat cells of viruses produced in MDMs from five different donors are shown. In c , results are expressed as the percentage of p24 production at each time point relative to that of shLuc-transduced Jurkat cells. Values are the means of two independent experiments performed with virus produced in MDMs from five different donors. Error bars represent the SEM. Statistical significance was determined using Students t test (ns, p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001)
Article Snippet: Immunoprecipitate and cell lysate proteins were then analyzed by Western blotting with anti-HA (3F10, Roche),
Techniques: Infection, Expressing, Cell Culture, Produced, shRNA
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: (A) Diagram depicting the purine enzymes predicted to be phosphorylated by canonical kinases based on a computational analysis with Scansite 4.0 software (see also Figure S3A). (B) Effects of EGF and SCH772984 on PFAS phosphorylation. FLAG-PFAS was immunopurified from serum-starved (15 hours) HEK293E cells treated for 30 min with DMSO or SCH772984 (ERKi, 1 μM) prior to stimulation with EGF (15 min, 50 ng/ml). The ratios of phosphorylated T619 peptides on PFAS to the total peptide levels, as measured by the total ion current (TIC) with LC-MS/MS, are plotted. Alignment showing the sequence conservation of T619 among PFAS orthologs (see also Figures S3B, S3C, and S3D). (C) In vitro kinase assays with active ERK1, ERK2 and PFAS variants (wild-type and mutant (T619A, S162A)) were performed with a 10 min reaction time and analyzed by autoradiography (see also Figures S3E, S3F, and S3G). (D) HeLa cells expressing empty vector (EV) or wild-type (WT) or T619A versions of FLAG-PFAS were serum-starved (15 hours) and stimulated with EGF (1 hour, 3 hours, 50 ng/ml). FLAG-immunoprecipitates were immunoblotted with a phospho-PFAS-T619 antibody (see also Figure S4A and S4B). (E) Cells were treated as in (D) and pretreated for 30 min with U0126 (MEKi, 10 μM) or SCH772984 (ERKi, 1 μM) prior to EGF stimulation (1 hour, 50 ng/ml). (F) HeLa cells were serum-starved (15 hours) and pretreated for 30 min with U0126 (MEKi, 10 μM), prior to 1-hour or 3-hour stimulation with EGF (50 ng/mL) (see also Figure S4C). (G) Cells were treated as in (D) and pretreated for 30 min with U0126 (MEKi, 10 μM) or rapamycin (Rap, 20 nM) prior to EGF stimulation (1 hour, 50 ng/ml) (see also Figures S4D and S4E). (H) Cells were treated as in (D), but were transfected with siRNAs targeting ERK1, ERK2, or both, or nontargeting controls (siCtl) (see also Figure S4F).
Article Snippet:
Techniques: Software, Phospho-proteomics, Liquid Chromatography with Mass Spectroscopy, Sequencing, In Vitro, Mutagenesis, Autoradiography, Expressing, Plasmid Preparation, Transfection
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: (A, B) The effects of acute ERK inhibition on the steady-state levels of purine intermediates, as measured via LC-MS/MS, in A549 (A) and SK-MEL-28 (B) cells following 15 hours of serum starvation and 1 hour of treatment with SCH772984 (ERKi, 1 μM) or DMSO. (C) Purine intermediates were measured as in (A, B) in HeLa cells serum starved for 15 hours and treated with vehicle or SCH772984 (ERKi, 1 μM) for 30 min prior to 1 hour of stimulation with EGF (50 ng/ml). (D) Schematic of the incorporation of nitrogen and carbon from glutamine and glycine into the purine ring. (E) Normalized peak areas of 15N-labeled purine intermediates, as measured by targeted LC-MS/MS, in HeLa cells serum starved for 15 hours and pretreated with vehicle or U0126 (MEKi, 10 μM) before stimulation with EGF (50 ng/ml) and labeling with 15N-(amide)-glutamine for 1 hour (see also Figure S1B). (F) Normalized peak areas of labeled glycine and purine intermediates HeLa cells transfected with either nontargeting control siRNA (siCtl), or siRNA against ERK1 and ERK2 (siERK1+2) for 48 hours and were treated as in (E) and labeled with 15N-13C2-glycine for the last hour prior to metabolite extraction (see also Figure S1C). (G) A549 and SK-MEL-28 cells serum-starved for 15 hours and treated with vehicle or SCH772984 (ERKi, 1 μM) before labeling with 15N-13C2-glycine for 1 hour (see also Figure S1D). The data are presented as the means ± SDs of biological triplicates and are representative of two independent experiments (A-F). * P<0.05 by two-tailed Student’s t test for pairwise comparisons (A, B, G) and one-way ANOVA with Tukey’s post hoc test for multiple pairwise comparisons (C, E, F).
Article Snippet:
Techniques: Inhibition, Liquid Chromatography with Mass Spectroscopy, Labeling, Transfection, Control, Extraction, Two Tailed Test
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: (A) Schematic of the purine synthesis pathways, including the pentose phosphate pathway, serine biosynthesis pathway and the mitochondrial THF cycles providing carbon and nitrogen for de novo purine nucleotide synthesis. Premade nucleobases, such as hypoxanthine, can sustain nucleotide synthesis via the purine salvage pathway. (B) Immunoblots assessing ERK and mTORC1 signaling; the relative incorporation of 14C from glycine, formate, and serine; and the relative incorporation of 3H from hypoxanthine into RNA and DNA. Labeling was performed for 3 hours under serum-free or EGF (50 ng/ml, 3 hours) stimulation conditions in the presence or absence of U0126 (MEKi, 10 μM) or SCH772984 (ERKi, 1 μM), reflecting de novo purine synthesis (14C-glycine, 14C-formate), one-carbon metabolism into purine nucleotides (3-14C-serine) and purine salvage pathway activity (3H-hypoxanthine) (see also Figure S2B and S2C). (C) HEK293E cells and MEFs were treated as in (B) but labeled with only 14C-glycine for 3 hours. The relative levels of incorporation of 14C from glycine into RNA are shown. Immunoblots performed in parallel to the radio-tracing experiments are shown. (D) As in (B, C), but the cells were cultured in 10% dialyzed serum and treated with vehicle or U0126 (MEKi, 10 μM, 2 hours) and labeled with 14C-glycine for 2 hours. (E) Relative incorporation of 14C-glycine into RNA, with labeling for 3 hours under serum-free conditions in the given cancer cell lines with high levels of ERK signaling (A549, SK-MEL-28, A375, and Panc1), treated with vehicle or U0126 (MEKi, 10 μM) for 3 hours (see also Figure S2D and S2E). (F) As in (D), HeLa cells were transfected with ERK1 and ERK2 siRNAs or nontargeting controls (siCtl) for 48 hours. Cells were cultured in 10% dialyzed serum for 15 hours and were then treated with vehicle or U0126 (MEKi, 10 μM, 2 hours) and concurrently labeled with 14C-glycine for 2 hours. The data are graphed as the means ± SDs of biological triplicates and are representative of at least two independent experiments (B-F). * P<0.05 by one-way ANOVA with Tukey’s post hoc test for multiple pairwise comparisons (B, C) and two-tailed Student’s t test for pairwise comparisons (D, E, F).
Article Snippet:
Techniques: Western Blot, DNA Labeling, Activity Assay, Labeling, Cell Culture, Transfection, Two Tailed Test
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: (A) Purine enzyme mRNA levels, as measured by qRT-PCR, in serum-starved HeLa cells (15 hours) and stimulated or not with EGF (50 ng/ml) in the presence or absence of U0126 (MEKi, 10 μM) for 1 or 3 hours. (B) Immunoblot showing all purine enzymes measured in (A). HeLa cells were serum starved for 15 hours and stimulated or not with EGF (50 ng/ml) over a time course (0.5, 4 or 8 hours) in the presence or absence of U0126 (MEKi, 10 μM). (C) Immunoblot showing all the purine enzymes measured in (A) and (B). A549 cells were serum starved for 15 hours and treated with vehicle or U0126 (MEKi, 10 μM) over a time course (0.5, 4 or 8 hours). (D, E) c-MYC knockdown did not abolish EGF- and MEK-dependent regulation of de novo purine synthesis in HeLa (D) and A549 (E) cells. Relative incorporation of radiolabels from 14C-glycine (3 hours of labeling) into RNA from HeLa and A549 cells 48 hours after transfection with c-MYC siRNAs or nontargeting controls (siCtl). Cells were serum starved (15 hours) and stimulated or not with EGF (50 ng/ml, 3 hours) (D) or were serum starved and treated with vehicle or MEKi (U0126, 10 μM) for 3 hours (E). The data are presented as the means±SEMs relative to unstimulated serum-starved HeLa cells (A). The data are plotted as the means ± SDs of biological triplicates (D, E). * P<0.05 by two-tailed Student’s t test for pairwise comparisons. The data are representative of at least three independent experiments (A-E).
Article Snippet:
Techniques: Quantitative RT-PCR, Western Blot, Knockdown, Labeling, Transfection, Two Tailed Test
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: (A) Immunoblots and normalized peak areas of 15N-13C-labeled purine intermediates measured in HEK293E cells transfected with either empty vector, constitutive active ERK2 (ERK2-CA), or catalytically inactive ERK2 (ERK2-KD) (see also Figure S5A). (B) Normalized peak areas of 15N-labeled metabolites measured in HEK293E ΔPFAS cells stably reconstituted with PFAS-WT, PFAS-S215A/T619A (2A) or PFAS-T619A cultured in dialyzed serum for 15 hours, isotopically labeled with 15N-(amide)-glutamine for 1 hour, and treated with vehicle (DMSO) or U0126 (MEKi, 10 μM). (C) Normalized peak areas of 15N-13C-labeled metabolites measured in HeLa ΔPFAS cells stably reconstituted with PFAS-WT, PFAS-2A or PFAS-T619A cultured in dialyzed serum for 15 hours, isotopically labeled with 15N-13C2-glycine for 1 hour and treated as in (B) (see also Figures S5E and S5F). (D) A549 ΔPFAS cells stably reconstituted with PFAS-WT, PFAS-S215A/T619A (2A) or PFAS-T619A cultured without serum for 15 hours, isotopically labeled with 15N-(amide)-glutamine for 1 hour, and treated as in (B). (E) HeLa ΔPFAS cells stably reconstituted with PFAS-WT, PFAS-S215A/T619A (2A) or PFAS-T619A were cultured in dialyzed serum, treated with vehicle or U0126 (MEKi, 10 μM) and concurrently labeled with 14C-glycine for 2 hours. Incorporation of the specific radiolabel into RNA was measured and normalized to the total concentration of RNA (see also Figure S5G). (F) A549 ΔPFAS cells stably reconstituted with PFAS-WT or PFAS-T619A were serum starved for 15 hours and treated as in (E) (see also Figure S5H). (B-D) CRISPR-mediated PFAS knockout validated in Figures S5B, S5C and S5D. The data are plotted as the means ± SDs of biological triplicates. * P<0.05 by one-way ANOVA with Tukey’s post hoc test for multiple pairwise comparisons (A-F). (A-F) The data are representative of at least two independent experiments.
Article Snippet:
Techniques: Western Blot, Labeling, Transfection, Plasmid Preparation, Stable Transfection, Cell Culture, Concentration Assay, CRISPR, Knock-Out
Journal: Molecular cell
Article Title: ERK2 phosphorylates PFAS to mediate posttranslational control of de novo purine synthesis
doi: 10.1016/j.molcel.2020.05.001
Figure Lengend Snippet: Highlights
Article Snippet:
Techniques: Virus, Recombinant, Transfection, Protease Inhibitor, Plasmid Preparation, Cell Viability Assay, Cloning, Software, Membrane
Journal: International Journal of Legal Medicine
Article Title: Effects of solvent-based adhesive removal on the subsequent dual analysis of fingerprint and DNA
doi: 10.1007/s00414-023-03042-w
Figure Lengend Snippet: a “Inhibitor screening” showed strong PCR inhibition with solvents S400 and “Turkish solution” . PCR products generated with template DNA (10 ng each), primers that target a 172 bp fragment of human mitochondrial DNA (mtDNA) and in the presence of various amounts of chemical solvents (S1–S8) were separated by agarose gel (1.5%) electrophoresis in 1 × TBE buffer. Aliquots of 5 μL from the PCRs were loaded. Lanes M: DNA ladder (low range, Thermo Fisher Scientific), lanes a–b: controls (CTRL) (lane a: no template control, lane b: amplification control (no solvent added)), lanes c–j: PCR was conducted in the presence of either of the following solvents; c: Un-du (code: S1), d: S400 (S2), e: Un-Stick (S3), f: BION1 (S4), g: Toluene (S5), h: “Turkish solution“ (S6), i: petroleum ether (7), and j: “Petrol mixture” (S8). The solvents had been substituted for the water component of the PCR mix to achieve a total concentration of 10% (first panel), 20% (second panel), 40% (third panel) and 60% (v/v) (fourth panel), respectively. The results indicated a strong inhibition potential for the solvents S400 and “Turkish solution”, and a relatively weak inhibitory effect with Un-stick and Toluene. No PCR inhibition was observed with the other solvents. b “Inhibitor screening” showed strong PCR inhibition with WD-40 (S9) . PCR products generated with template DNA (10 ng each), primers that target a 172 bp fragment of human mtDNA and in the presence of various amounts of WD-40 (solvent S9) were separated by agarose gel (1.5%) electrophoresis in 1 × TBE buffer. Aliquots of 5 μL from PCRs were loaded. Lanes M: DNA ladder (GeneRuler 100 bp, Thermo Fisher Scientific), lanes a–b: controls (CTRL) (lane a: no template control, lane b: amplification control (without addition of solvent)), lanes c–e: PCR was conducted in the presence of WD-40 in a total concentration of 10% (lane c), 20% (d) and 40% (v/v) (e), respectively
Article Snippet: Lanes M:
Techniques: Inhibition, Generated, Agarose Gel Electrophoresis, Electrophoresis, Control, Amplification, Solvent, Concentration Assay
Journal: International Journal of Legal Medicine
Article Title: Effects of solvent-based adhesive removal on the subsequent dual analysis of fingerprint and DNA
doi: 10.1007/s00414-023-03042-w
Figure Lengend Snippet: a “Dry exposure” assessment revealed no enhanced adverse effects of solvents (S1–S9) on DNA quantity and quality, compared to water . The bar graphs shown were generated using MS Excel (2016) by plotting DNA quantitation results from real-time PCR analysis [calculated mean values for the small autosomal target (DNA [ng/µL], upper panel) and degradation index (DI) (lower panel)], respectively; each on the y -axis)] against the incubation time (on the x -axis; in ordinal scale). Mixed samples (50 μL aliquots of solvents S1 to S9 and water as control (CTRL), respectively, each spiked with 50 ng DNA) were applied to sterile cotton swabs. Swabs were incubated at room temperature (RT) in the dark for five minutes (5 min), one hour (1 h), 18 h (overnight, ON) or one week (1 w), allowing the solvent-DNA mixture to evaporate and dry freely. Each combination (type of solvent and time point) was tested in duplicate samples. Subsequently DNA was purified from swabs and subjected to quantitation using the Quantifiler HP Kit. b “Wet exposure” assessment revealed pronounced adverse effects of certain solvents (S3 > S7 > S1 > S4) on the quantity and quality of recovered DNA . The bar graphs shown were generated using MS Excel (2016) by plotting DNA quantitation results from real-time PCR analysis [calculated mean values for the small autosomal target (DNA [ng/µL], upper panel) and degradation index (DI) (lower panel), respectively; each on the y -axis)] against the incubation time (on the x -axis; in ordinal scale). Mixed samples (100 μL aliquots of solvents S1 to S9 and water as control (CTRL), respectively, each spiked with 50 ng DNA) were transferred to closed sample tubes to prevent the evaporation of volatile organic compounds and incubated at room temperature (RT) in the dark for five minutes (5 min), one hour (1 h), 18 h (overnight, ON) or one week (1 w). Each combination (type of solvent and time point) was tested in duplicate samples. Subsequently DNA was purified and subjected to quantitation using the Quantifiler HP Kit
Article Snippet: Lanes M:
Techniques: Generated, Quantitation Assay, Real-time Polymerase Chain Reaction, Incubation, Control, Sterility, Solvent, Purification, Evaporation
Journal: International Journal of Legal Medicine
Article Title: Effects of solvent-based adhesive removal on the subsequent dual analysis of fingerprint and DNA
doi: 10.1007/s00414-023-03042-w
Figure Lengend Snippet: Solvent treatment via the reverse side removes DNA deposits from the adhesive side of an affixed stamp, but hardly affects DNA deposits on the non-adhesive side or the envelope . Displayed stacked bar charts were built in MS Excel (2016) with DNA quantitation data from real-time PCR analysis [mean values for the small autosomal target (“DNA yield (ng/µL)”)] in correspondingly treated samples from stamps (black) and envelope (grey) (on the y -axis) were plotted against “Treatment” (i.e. time of incubation with “Turkish solution” (S6) prior to physical separation of affixed stamps from envelope plus controls; on the x -axis in ordinal scale). Three different types of test specimens were prepared: a “Adhesive” (upper panel) i.e. postage stamps with 50 ng DNA applied to the adhesive side and affixed to an envelope; b “Non-Adhesive” (middle panel) i.e. postage stamps with 50 ng DNA applied to the non-adhesive side and affixed to an envelope; c “Envelope” (lower panel) i.e. envelope treated with 50 ng DNA in marked areas and then sealed with stamps. Prepared specimens were stored overnight (18 h) at room temperature and in the dark. A time-series of solvent-treatment (300 μL of “Turkish solution” applied to the envelope at the stamp’s back-side) prior to the complete physical separation (stamp from envelope paper) was performed and included the following time points: 10, 60 and 300 s and untreated control (0 s). The following controls (without solvent-treatment) were also included: stamps with DNA deposition (Ctrl_S), not affixed to an envelope, and envelope with DNA deposition (Ctrl_E) but no stamp affixed, respectively. Each combination (type of sample/solvent and time point) was tested in duplicate. DNA was isolated from stamps and paper and subjected to quantitation using the Quantifiler HP Kit
Article Snippet: Lanes M:
Techniques: Solvent, Adhesive, Quantitation Assay, Real-time Polymerase Chain Reaction, Incubation, Control, Isolation
Journal: International Journal of Legal Medicine
Article Title: Effects of solvent-based adhesive removal on the subsequent dual analysis of fingerprint and DNA
doi: 10.1007/s00414-023-03042-w
Figure Lengend Snippet: a Preparation and processing of mock evidence for the assessment of combined effects of dactyloscopy and adhesive removal on DNA recovery . Shown is the basic scheme for the preparation of mock evidence (four envelopes, E1 to E4). Nine square areas (25 × 25 mm 2 ) were drawn (in three rows of three squares each) on each envelope and treated (from left to right) with DNA (50 ng each), fingerprint (FP) and untreated (CTRL), respectively. In addition, nine self-adhesive postage stamps were affixed to each envelope in three rows of three. The upper row of stamps served as a control (No DNA). In the second row, DNA was applied to the non-adhesive side of the stamps (DNA Non-Adhesive). In the third row, the stamps were first treated with DNA on the adhesive side and later affixed to the envelope (DNA Adhesive). Prepared envelopes were stored at room temperature in the dark for 1 week. b Flow chart providing an overview on treatments of mock evidence (envelopes E1 to E4) . Three envelopes (E1 to E3) were processed first using 1,2-indanedione-zinc (Ind-Zn), followed by ninhydrin treatment and incubation in a climate chamber for 48 h. Then the envelopes were cut open laterally. Removal of the stamps was performed either with the aid of adhesive release agents [E1: “Turkish solution“ (S6) and E2: Un-Du (S1)] or purely mechanically using tweezers (E3). Envelope E4 was left untreated (no Ind-Zn/ninhydrin) and stamps were removed mechanically. DNA was isolated from stamps and papers and subjected to quantitation using the Quantifiler HP kit. c Treatment with conventional fingerprint reagents lead to a significant reduction in the amounts of DNA recovered from stamps, while the additional use of adhesive removers did not significantly enhance this effect . Displayed stacked bar charts were built in MS Excel (2016) with DNA quantitation data from real-time PCR analysis [mean values for the small autosomal target (“DNA yield (ng/µL)”)] in correspondingly treated samples from stamps (black) and envelope (grey) (on the y -axis) were plotted against “Treatment” (mock evidence (envelopes E1 to E4) was prepared and processed, as described in Fig. 4a, b). The impact of each treatment was tested in triplicate. Results from testing three different sample types collected from mock evidence are shown here: “Envelope” i.e. excised areas (25 × 25 mm 2 ) from envelope with 50 ng DNA deposition. “Non-Adhesive” i.e. postage stamps, each with 50 ng DNA applied to the non-adhesive side and affixed to the envelope; “Adhesive” i.e. stamps treated with 50 ng DNA on the adhesive side and later affixed to the envelope
Article Snippet: Lanes M:
Techniques: Adhesive, Control, Incubation, Isolation, Quantitation Assay, Real-time Polymerase Chain Reaction
Journal: Molecular Therapy. Nucleic Acids
Article Title: Effective Small Interfering RNA Therapy to Treat CLCN7 -dependent Autosomal Dominant Osteopetrosis Type 2
doi: 10.1038/mtna.2015.21
Figure Lengend Snippet: In vitro and in vivo tests of CLCN7 mutant -specific siRNAs . ( a ) Cartoon depicting the pEGFP-C1 vector used in the study. ( b ) HEK293 cells stably transfected with the pEGFP-C1 vector carrying the indicated mutations. Expression of the CLCN7 gene was quantified by real-time RT-PCR on RNA extracted from mutant transfectants, against cells transfected with the empty vector, which did not express CLCN7 mRNA (first bar from left). ( c–e ) HEK293 cells transfected with the indicated vectors, were treated with the CLCN7 mutant -specific siRNA listed in as the most effective per each mutation. Concentration-dependent regulation of CLCN7 assessed by real-time RT-PCR, normalized with GAPDH . ( f ) RT-PCR using primer pairs specific for the Clcn7 G213R mRNA showing transcript amplification only in heterozygous ( Clcn7 G213R/WT ) and homozygous ( Clcn7 G213R/G213R ) osteoclasts, while in wild-type osteoclasts ( Clcn7 WT/WT ) no transcript was amplified. ( g ) Direct DNA sequencing of the amplified transcript shown in f for the Clcn7 G213R/WT osteoclasts, demonstrating only the mutant sequence. ( h ) Osteoclasts generated from the bone marrow mononuclear cells of Clcn7 WT/WT and Clcn7 G213R/WT mice were treated with the indicated concentration of scrambled (SCR) or Clcn7 G213R -specific siRNA. Real-time RT-PCR was performed using the primer pairs specific for the mutant transcript validated in ( f ) and ( g ). ( i ) Osteoclasts were generated from the bone marrow mononuclear cells of Clcn7 WT/WT and Clcn7 G213R/WT mice onto bone slices and treated with the indicated concentration of SCR and Clcn7 G213R -specific siRNA. At the end of experiment, cells were removed by sonication and bone resorption evaluated by the pit assay. ( j ) Three-month-old Clcn7 WT/WT mice were injected once i.p. with 4 mg/kg of Clcn7 G213R -sticky siRNA jetPEI conjugate and sacrificed at the indicated time point. Sera were collected and evaluated for total RNA concentration by Nanodrop. ( k ) Ten-day-old Clcn7 G21R/WT mice were injected once i.p. with the indicated doses of SCR- or of Clcn7 G213R -sticky siRNA jetPEI conjugate. After 48 hours, mice were sacrificed, RNA was extracted from tibias, and evaluated by real-time RT-PCR using the primer pairs specific for the Clcn7 G213R mRNA validated in ( f ) and ( g ). In b–e, h–k data are the mean ± SD of three independent experiments or three animals/group. b–e,h,I,k : Student's t -test. j : one-way analysis of variance (ANOVA). For c–e , statistics was also performed by one way ANOVA (shown in Supplementary Table S3 ).
Article Snippet: The
Techniques: In Vitro, In Vivo, Mutagenesis, Plasmid Preparation, Stable Transfection, Transfection, Expressing, Quantitative RT-PCR, Concentration Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, DNA Sequencing, Sequencing, Generated, Sonication, Injection
Journal: Molecular Therapy. Nucleic Acids
Article Title: Effective Small Interfering RNA Therapy to Treat CLCN7 -dependent Autosomal Dominant Osteopetrosis Type 2
doi: 10.1038/mtna.2015.21
Figure Lengend Snippet: In vivo treatment and safety study . Ten-day-old Clcn7 G213R/WT mice were injected i.p. with 4 mg/kg of Clcn7 G213R -sticky siRNA jetPEI conjugate, three times a week for 4 weeks. At the end of the experiments, mice were sacrificed and ( a ) the indicated organs were subjected to histopathological evaluation by hematoxylin/eosin staining (Bar = 100 µm for spleen and kidney, 20 µm for liver). ( b ) Sera were collected and analyzed by the Reflotron method for the indicated biomarkers of kidney and liver disease, and for the ADO2 biomarker CK. Normal values are between the two dotted lines. ( c ) RNA was extracted from the indicated organs and subjected to real time RT-PCR using primer pairs specific for the Clcn7 G213R mRNA, normalized for gapdh . ( d ) Ten day-old Clcn7 WT/WT and Clcn7 G213R/WT were treated with 4 mg/kg of scrambled- (SRC) or Clcn7 G213R -sticky siRNA jetPEI conjugate, three times a week for 2 and 4 weeks. At the end of the experiments, mice were sacrificed, then the serum biomarker of bone resorption, CTX, the serum osteoclast biomarker, TRAcP (5b isoform), and the CTX/TRAcP ratio were evaluated after 2 and 4 weeks of treatment. ( e ) µCT analysis of proximal tibias of mice treated with 4 mg/kg of Clcn7 G213R -sticky siRNA jetPEI conjugate, three times a week for 2 weeks, followed by measurements of trabecular ( f ) bone volume over total tissue volume (BV/TV), ( g ) trabecular number (Th.N), ( h ) thickness (Tb.Th), and ( i ) separation (Tb.Sp). Data are ( a,e ) representative or ( b–d, f–i ) the mean ± SD of four to seven mice per group (Student's t -test). For f–i statistics was also performed by one-way analysis of variance (shown in Supplementary Table S3 ).
Article Snippet: The
Techniques: In Vivo, Injection, Staining, Biomarker Discovery, Quantitative RT-PCR
Journal: Molecular Therapy. Nucleic Acids
Article Title: Effective Small Interfering RNA Therapy to Treat CLCN7 -dependent Autosomal Dominant Osteopetrosis Type 2
doi: 10.1038/mtna.2015.21
Figure Lengend Snippet: Rescue of the bone phenotype . Ten-day-old Clcn7 WT/WT and Clcn7 G213R/WT were treated with 4 mg/kg of scrambled- (SRC) or Clcn7 G213R -sticky siRNA jetPEI conjugate, three times a week for 4 weeks. At the end of the experiments, mice were sacrificed and their bone phenotype analyzed. ( a ) µCT analysis of proximal tibias. ( b ) Trabecular bone volume over total tissue volume (BV/TV). ( c ) Trabecular number (Tb.N). ( d ) Trabecular thickness (Tb.Th). ( e ) Trabecular separation (TB.Sp). ( f ) Serum concentration of ParaThyroid Hormone (PTH). ( g ) Histochemical TRAcP staining to evaluate osteoclasts (purple cells). Bar = 100 µm. ( h ) Osteoclast surface over bone surface (Oc.S/BS). ( i ) Osteoclast number over bone perimeter (Oc.N/B Pm). ( j ) Transcriptional expression, by real-time RT-PCR on RNA extracted from the whole femurs of osteoclast ( Tracp and Cathepsin K ( CatK )) and osteoblast ( Alkaline phosphatase ( ALP ) and Runt-related transcription factor 2 ( Runx 2 )) genes normalized with gapdh . ( k ) Eroded surface over bone surface (ES/BS). ( l ) Representative images of the secondary spongiosa (upper panels) and measurement of cartilage area/trabecular area (lower panel). Arrows: cartilage remnants. Bar = 50 µm. Results are ( a,g,i (upper panels)) representative or ( b–f,h–i (lower panel)) the mean ± SD of three to seven mice/group (Student's t -test). In d , P > 0.2. For b–f,h–l statistics was also performed by one-way analysis of variance (shown in Supplementary Table S3 ).
Article Snippet: The
Techniques: Concentration Assay, Staining, Expressing, Quantitative RT-PCR
Journal: Molecular Therapy. Nucleic Acids
Article Title: Effective Small Interfering RNA Therapy to Treat CLCN7 -dependent Autosomal Dominant Osteopetrosis Type 2
doi: 10.1038/mtna.2015.21
Figure Lengend Snippet: Cortical, growth plate, osteoblast, dynamic, and bone quality variables . Ten-day-old Clcn7 WT/WT and Clcn7 G213R/WT were treated with 4 mg/kg of scrambled- (SRC) or Clcn7 G213R -sticky siRNA jetPEI conjugate, three times a week for 4 weeks. At the end of the experiments, mice were sacrificed and their bone phenotype analyzed. ( a ) Cortical thickness (Cor.Th). ( b ) Growth plate width. ( c ) Osteoblast surface over bone surface (Ob.S/BS). ( d ) Histological images of osteoid (arrows). Bar = 5 µm. ( e ) Osteoid volume over bone volume (OV/BV). ( f ) Calcein labeling (green fluorescence) of mineral deposition (double arrowheads). Bar = 2 µm. ( g ) Mineral apposition rate (MAR). ( h ) Mineralized surface over bone surface (MS/BS). ( i ) Bone formation rate (BFR). ( j ) Total indentation distance (TDI). ( k ) First-cycle indentation distance (ID). ( l ) Touchdown distance (TDD). Results are ( d,f ) representative or ( a–c,e,g–l ) the mean ± SD of three to seven mice/group (Student's t -test). In a–c,e,g–i , P > 0.2. For a–c,e,g–l statistics was also performed by one-way analysis of variance (shown in Supplementary Table S3 ).
Article Snippet: The
Techniques: Labeling, Fluorescence
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques:
Journal: Cancer cell
Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.
doi: 10.1016/j.ccell.2020.11.004
Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138
Techniques: Activation Assay, Immunopeptidomics, Generated
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: In (A) SCC-4 and (B) Tca8113 OTSCC cells, the protein levels of PODXL and BMI1 were determined with western blot analysis in normal control cells (NC, lane 1), cells stably transfected with the empty pcDNA 3.1 vector (VC, lane 2), cells stably transfected with PODXL (lane 3), cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I, lane 4), cells stably transfected with Bmi1 (lane 5), cells stably transduced with scramble control shRNA (SC, lane 6), cells stably transduced with PODXL-shRNA (lane 7), cells stably transduced with BMI1-shRNA (lane 8), cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA, lane 9), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA, lane 10). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) blotting was used as a loading control. Density of the Western blots was measured by densitometry, and the density of the PODXL and the Bmi1 blots was normalized against that of the GAPHD blot in the same sample to obtain a relative blot density to represent relative PODXL and Bmi1 content in each sample, respectively. a p <0.05 vs. controls (NC, VC and SC); b p <0.05 vs. PODXL; c p <0.05 vs. PODXL+FAK-I; d p <0.05 vs. Bmi1; e p <0.05 vs. PODXL-shRNA; f p <0.05 vs. Bmi1-shRNA; g p <0.05 vs. PODXL+Bmi1-shRNA.
Article Snippet:
Techniques: Western Blot, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: In (A) SCC-4 and (B) Tca8113 OTSCC cells, mRNA levels of Bmi1 were determined with real-time RT-PCR in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA). a p <0.05 vs. controls (NC, VC and SC); b p <0.05 vs. PODXL; c p <0.05 vs. PODXL+FAK-I; d p <0.05 vs. Bmi1; e p <0.05 vs. PODXL-shRNA; f p <0.05 vs. Bmi1-shRNA; g p <0.05 vs. PODXL+Bmi1-shRNA.
Article Snippet:
Techniques: Quantitative RT-PCR, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: (A) SCC-4 and (B) Tca8113 OTSCC cells were transfected with human Bmi1 promoter/luciferase reporter plasmids and then cultured for 24 hours. Luciferase activities were determined in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA). The luciferase activity was expressed as fold changes to that of NC (designated as 1).
Article Snippet:
Techniques: Transfection, Luciferase, Cell Culture, Control, Stable Transfection, Plasmid Preparation, Transduction, shRNA, Activity Assay
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: (A) SCC-4 and (B) Tca8113 OTSCC cells were pre-treated with transcription inhibitor actinomycin D (1 mg/mL) for 30 minutes, and then cultured for 1, 2 or 4 hours in medium containing actinomycin D (1 mg/mL). The Bmi1 mRNA level were then determined with real-time RT-PCR in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA).
Article Snippet:
Techniques: Cell Culture, Quantitative RT-PCR, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: (A) SCC-4 and (B) Tca8113 OTSCC cells were treated with or without various concentrations of cisplatin for 48 hours. The half maximal inhibitory concentration (IC50) values were determined in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA). The IC50 dose-response curves were plotted with GraphPad Prism 5.0 (GraphPad Software). The dose-response curves for VC and SC in both SCC-4 and Tca8113 cells are presented in , because they mostly overlap with the dose-response curve of NC. IC50 values (mean±SD) are presented by histograms. a p <0.05 vs. controls (NC, VC and SC); b p <0.05 vs. PODXL; c p <0.05 vs. PODXL+FAK-I; d p <0.05 vs. Bmi1; e p <0.05 vs. PODXL-shRNA; f p <0.05 vs. Bmi1-shRNA; g p <0.05 vs. PODXL+Bmi1-shRNA.
Article Snippet:
Techniques: Concentration Assay, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA, Software
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: (A) SCC-4 and (B) Tca8113 OTSCC cells were treated with cisplatin (10 μM) for 12 and 24 hours. Apoptosis was measured with a microplate reader-based TiterTACS in situ apoptosis detection kit (R&D systems) in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA). Cell apoptosis was shown as fold changes to that of untreated NC (at 0 hour of treatment; designated as 1). * p <0.05 vs. controls (NC, VC and SC).
Article Snippet:
Techniques: In Situ, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA
Journal: PLoS ONE
Article Title: Bmi1 Essentially Mediates Podocalyxin-Enhanced Cisplatin Chemoresistance in Oral Tongue Squamous Cell Carcinoma
doi: 10.1371/journal.pone.0123208
Figure Lengend Snippet: In (A) SCC-4 and (B) Tca8113 OTSCC cells, the FAK activity was determined with a Universal Tyrosine Kinase Assay kit (Takara Biomedical Technology) in normal control cells (NC), cells stably transfected with the empty pcDNA 3.1 vector (VC), cells stably transfected with PODXL, cells stably transfected with PODXL and treated with focal adhesion kinase (FAK) inhibitor 14 (50 M) for 24 hours (PODXL+FAK-I), cells stably transfected with Bmi1, cells stably transduced with scramble control shRNA (SC), cells stably transduced with PODXL-shRNA, cells stably transduced with BMI1-shRNA, cells stably transfected with PODXL and transduced with BMI1-shRNA (PODXL+BMI1-shRNA), and cells stably transfected with Bmi1 and transduced with PODXL-shRNA (Bmi1+PODXL-shRNA). The FAK activity was shown as fold changes to that of NC (designated as 1). a p <0.05 vs. controls (NC, VC and SC); b p <0.05 vs. PODXL; c p <0.05 vs. PODXL+FAK-I; d p <0.05 vs. Bmi1; e p <0.05 vs. PODXL-shRNA; f p <0.05 vs. Bmi1-shRNA; g p <0.05 vs. PODXL+Bmi1-shRNA.
Article Snippet:
Techniques: Activity Assay, Universal Tyrosine Kinase Assay, Control, Stable Transfection, Transfection, Plasmid Preparation, Transduction, shRNA